pmt flag relish (Addgene inc)
Addgene inc is a verified supplier 
94
Structured Review
Addgene inc
pmt flag relish
Pmt Flag Relish, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmt+flag+relish/pMT-Flag-RELISH+(Plasmid+%2363750)/pmc12805896-106-6-7
Average 94 stars, based on 1 article reviews
Pmt Flag Relish, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmt+flag+relish/pMT-Flag-RELISH+(Plasmid+%2363750)/pmc12805896-106-6-7
Average 94 stars, based on 1 article reviews
pmt flag relish - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Injection:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Transgenic Assay:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Generated:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Polymerase Chain Reaction:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Amplification:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Sequencing:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Clone Assay:Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTC ACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924 ; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGAT GACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGA TGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: This plasmid was injected into w1118 embryos (Rainbow Transgenic Flies). w1118 ; UAS-HDAC6-HA transgenic reporter flies were generated by PCR amplification of HDAC6 coding sequence with specific primers (F: AACAGATCTGCGGCCGCGGCTCGAGGGTACATGAGCCCGCCCATCGTCACGC, R: GGTTCCTTCACAAAGATCCTCTAGAGTCAAGCGTAATCTGGAACATCGTA) from UGO01255 (DGRC Stock 1663924; https://dgrc.bio.indiana.edu//stock/1663924; RRID: DGRC_1663924), and then cloned into a pUASt plasmid. .. This plasmid was injected into w1118 ; attp40 embryos (Rainbow Transgenic Flies). w1118 ; UAS-Relish-V5 transgenic reporter flies were generated by PCR amplification of Relish coding sequence with specific primers (F: AAGAGAACTCTGAATAGGGAATTGGGAATTCGACTACAAGGATGACGATGACAAA, R: GGTTCCTTCACAAAGATCCTCTAGAGGTACCTCAATGGTGATGGTGATGATGACC) from Article Title: NF-κB restrains nutrient-dependent transcription programs through chromatin modulation in Drosophila Article Snippet: .. Relish coding sequence was amplified from |